Nov 18 2009Why Don't House Cats Grow Into Lions?
This is a clever answer to a query posed in Yahoo! Answers. You can't argue the answerer didn't give them exactly what they asked for, even if it's not what they wanted. Because, let's face it, a lot of people don't even know what they want. I'm looking at you, Mrs.Takes 8 Minutes To Order at the Taco Bell Drive Thru. Next time I'm ramming!
Thanks to TARDISlover, who likes it bigger on the inside.
Related Stories
Genius!: Mug With A Cookie Holding Shelf (10/08/2009)
Video Game Character Facebook Statuses (09/30/2009)
There's An App For That: iPhone Fauxmercial (08/29/2009)
Magical: This Three Keyboard Cat Moon Shirt (07/21/2009)
Reader Comments
1. naas - November 18, 2009 10:31 AM
in mother russia.....
2. Closet Nerd - November 18, 2009 10:32 AM
Thats like when kids would ask the teacher, "Can I go to the bathroom?"
And he would reply, "I don't konw. Can you?"
3. ~☻,_∫∫ ∕∕-][ Ỵ ([¦¦ ([]) ][-¦¦ ☻~ - November 18, 2009 10:32 AM
omg ever seen the new dog sized cats that are part leopard?
4. That uncle who did that bad thing we don't speak about - November 18, 2009 10:33 AM
This is up there with "why won't my parakeet eat my diarrhea", except not quite as epic.
5. ~☻,_∫∫ ∕∕-][ Ỵ ([¦¦ ([]) ][-¦¦ ☻~ - November 18, 2009 10:35 AM
the Ashera, a combination of an African Serval - a medium-sized wildcat - an Asian leopard wildcat, and a domesticated house ca
http://ipetnews.com/wp-content/uploads/2007/11/designercat.jpg
6. Dr. Nappy - November 18, 2009 10:37 AM
Loves it bigger on the inside... heh not bad GW... not bad.
7. somerandomguy - November 18, 2009 10:41 AM
Could be wrong but just have a feeling someone was like "how can be smart yet a smartass using my knowledge of housecat DNA? I know!!! I'll post some asinine question on yahoo answers pretending to be someone else!" Just sayin.
8. belbo - November 18, 2009 10:42 AM
baaaaaaaaaaaaaaahahahahahhahahahahhahaha THIS IS FRICKEN CLASSIC! made my bedtime :)
9. naas - November 18, 2009 10:50 AM
@5 I thought savannah cats were bad enough as is, who in the hell crossbread that thing in your link, death?
@7 I love when someone finishes their rant with 'just sayin' because if you hadn't concluded with that nobody would know what you're saying, just sayin
10. Pat - November 18, 2009 10:52 AM
@4 I dunno, man. I think this is pretty epic.
11. 24-bit whore - November 18, 2009 10:57 AM
@4 & 10 This doesn't begin to scratch the surface of epic, it's quite uneventful and unclimatic actually. (unless you live in a box in a dungeon & haven't come to terms with your sexuality yet)
Maybe you two should speed date or something, it could be an epic night for both of you overplaying the word epic.
12. 24-bit whore - November 18, 2009 10:58 AM
....just sayin
13. amanda - November 18, 2009 11:02 AM
the screen names "some fool" and "me" crack me up :)
14. boonie - November 18, 2009 11:03 AM
LAME.... next post pls
15. LSDiesel - November 18, 2009 11:05 AM
I like tuhdoles.
16. Closet Nerd - November 18, 2009 11:08 AM
I thought it was pretty clever..... just sayin.
17. JADE - November 18, 2009 11:10 AM
*Stupid*
18. Black - November 18, 2009 11:12 AM
I don't gwet it. Was that the right answer and it's just hard to understand, or is it the wrong answer?
19. Zing! - November 18, 2009 11:18 AM
@15 at first I was like o.O but then I was like XD!
20. naas - November 18, 2009 11:19 AM
@18 yeah man, that's the right answer. There's no joke here, that's actually important information for people with cats
21. ~☻,_∫∫ ∕∕-][ Ỵ ([¦¦ ([]) ][-¦¦ ☻~ - November 18, 2009 11:27 AM
@20 yeah cause everyone knows cat people have to preform gene therapy on their cats to make sure they don't have a growth spurt over night and eat their children
22. The Geekologie Writer - November 18, 2009 11:27 AM
First!
23. Closet Nerd - November 18, 2009 11:30 AM
@21 I preform jean therapy on my cat every night.
We got a nice pair of Levi's jeans we put on him, then start his physical therapy sessions.
24. Freddy K - November 18, 2009 12:04 PM
Love it. This is exactly the smart-arse response needed. Just saying.
cat twat
25. Name (required): - November 18, 2009 12:20 PM
Um...Okay...Have I not had enough coffee yet this morning?
I don't get it?
26. martygras9 - November 18, 2009 12:43 PM
sad...i don't get it either.
27. art vandelay - November 18, 2009 12:46 PM
thats not the real answer
28. naas - November 18, 2009 12:55 PM
@25 & 26 that makes it even funnier, just sayin
29. Luiso - November 18, 2009 1:07 PM
Must be the DNA sequence of the cat's growth hormone.
30. Dan - November 18, 2009 3:01 PM
Boo! Screen-capping his own comment automatically makes this lame.
31. those who "dont get it" - November 18, 2009 4:08 PM
whats not to get
32. suomynonA - November 18, 2009 4:25 PM
@52
Get out of here you troll!
Anyways, awesome cat in the pic in the link in the comments somewhere.
And, I think there's a typo, right between the T and the A but before the G, should have been a C there too.
33. livingjetlag - November 18, 2009 9:15 PM
I think the attributing that nonsense to PubMed is the best part, assuming they don't sue.
34. Wrath001M - November 18, 2009 11:15 PM
HAHAHAHAHAHA, AWSOME though I think the code is like a a thousand times longer then just that slice of DNA. Still that is clever and funny.
35. Jaded Icon - November 19, 2009 7:52 AM
Well the actually DNA sequence would be a lot longer than that. But I like the ironic tone to his answer......just saying.
36. bob - November 20, 2009 1:34 AM
What an idiot. There's a typo in line 421, it should read as follows.
1 ACCGTTCGCAAGAAATGCGCAGAACAGCAAGTTCTATTTA…
61 GAACTTGCGTAACAGAATCAGTTGAGCTTAATGTCAGCCT…
121 CCTAGAGGATGTTGCTTGTCATGATACGCATGAATCGTCA…
181 GAATGAAGAGTCTCGTTGCCAGTATAAAAGACTCGTATTC…
241 AGTGCAGCTCACAGAACTCATCGTTATCCTGTTGATCAGA…
301 TTGGATCGAACTCGATTTCTGACTGGGTTGGAAGGCAAGA…
361 TTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGA…
421 TTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGG…
481 TAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTAC…
541 ATTGTTTGTGCACTTGCCGGCATGCCGGTAGAGGTGTGGT…
601 TATACCTGAGAAAGCAACCTGACCTACAGGAAAGAGTTAC…
661 TTTAAAACCTAAGAGTCACTTTAAAATTTGTATACACTTA…
721 ATAATAAAAATCATAAATCATAAGAAATTCGCCCGGAATT…
781 GATCCACCTTTCTGAGCCACTTCCGGTACTGGCACAGCCT…
841 GTGTCGGTAGCTTGTTTGTTTGAAGAAGGCCTTGAATTAG…
901 GTATCCAGATTGGTTACGGTAACAGATGGTAAGTTCAGGG…
961 TAGTTGCTGTTCTCAGCCTTCCCAGGAGTGATGGCACCTG…
1021 GGCACTCAGTTGGCTCACAGTTGGAGAGACAGCCTCCGTC…
1081 AAGGAATCACTGCTGCCTCTATTGGACTTGGAGCCACCCC…
1141 TCTCCCGCTTTCTCTTTCTTTGGGGAATGGCGATTATTTT…
1201 CTCTCAAACATCTTTCGAGTCTCTGTGAACTTAGCATACG…
1261 TCAAATCTGCTAATCCGT
37. Yab - November 20, 2009 1:28 PM
I'm really disapointed, this is not even cat DNA.
That's a yeast cloning factor
38. Discoman - November 21, 2009 6:05 PM
yeah really-thats the wrong gene and only half of it.